Trends
Sci.
2025; 22(5): 9485
Curcumin as an Antitumor Agent: Targeting Cancer Stem Cell Markers in Glioblastoma through In Silico and In Vitro Approaches
Diki Diki1,*, Wahyu Widowati2, Sobia Tabassum3, Annisa Firdaus Sutendi4,
Dwi Nur Triharsiwi4 and Dhanar Septyawan Hadiprasetyo4,5
1Department of Biology, Faculty of Science and Technology, Universitas Terbuka, Tangerang Selatan, Indonesia
2Faculty of Medicine, Maranatha Christian University, Bandung, Indonesia
3Department of Biological Sciences, Faculty of Sciences, International Islamic University Islamabad,
Islamabad, Pakistan
4Biomolecular and Biomedical Research Center, Aretha Medika Utama, Bandung, Indonesia
5Faculty of Pharmacy, Universitas Jenderal Achmad Yani, Cimahi, Indonesia
(*Corresponding author’s e-mail: [email protected])
Received: 9 December 2024, Revised: 7 January 2025, Accepted: 5 February 2025, Published: 25 March 2025
Abstract
Glioblastoma is prevalent and aggressive primary malignant brain tumor in adults with an annual incidence rate approximately 0.59 to 5 cases per 100,000 individuals. Curcumin, a bioactive compound from Curcuma longa, holds promise as a potential antitumor agent for use in drug or functional food development. This study aimed to analyze the in silico and in vitro antitumor potency of curcumin. Molecular docking was conducted to assess curcumin’s interactions with tumor-related proteins SOX-2, OCT-4, and IGFBP2. In vitro experiments involved quantifying the SOX-2 and OCT-4 genes expression in glioblastoma (GBM) cells treated with curcumin using qRT-PCR method. Molecular docking revealed that curcumin binds effectively to all target proteins, with SOX-2 and OCT-4 exhibiting the lowest binding energy also the highest number of interactions, indicating stronger binding. In vitro analysis demonstrated that curcumin significantly downregulated the SOX-2 and OCT-4 expression in GBM cells, surpassing the effects of temozolomide, a standard cancer treatment. These findings highlight curcumin's potential as an antitumor agent by targeting cancer stem cell markers and pathways. This study provides foundational evidence for the future development of curcumin-based drugs or functional foods aimed at cancer therapy.
Keywords: Antitumor, Curcumin, IGFBP2, In silico, In vitro, Glioblastoma, OCT-4, SOX-2
Introduction
Glioblastoma represents the most common and highly aggressive form of primary malignant brain tumor found in adults. International research indicates an annual incidence rate varies across different regions, approximately 0.59 to 5 cases per 100,000 individuals, with some studies reporting an increasing trend in incidence over time [1]. Glioblastoma exemplifies the challenges of managing malignancies with poor prognoses and limited therapeutic options. This urgency underscores the need for innovative approaches targeting the underlying mechanisms of tumor progression, particularly focusing on cancer stem cells (CSCs), that involved in metastasis, tumorigenesis, and therapy resistance.
Among the key markers of CSCs, SRY-Box Transcription Factor 2 (SOX-2) and Octamer-binding transcription Factor 4 (OCT-4) are critical factors of transcription that regulate pluripotency and self-renewal, making them essential for CSCs survival and proliferation. High expression of these markers has been linked to aggressive tumor behavior and resistance to conventional therapies [2,3]. Additionally, Insulin-like Growth Factor Binding Protein 2 (IGFBP2) has a pivotal role in modulating the tumor microenvironment by regulating growth factor availability, thereby promoting tumor growth and metastasis [4]. In addition, IGFBP2 acts as a hub of an oncogenic network [5]. These proteins represent promising therapeutic targets, as their inhibition could impair CSC maintenance and limit tumor progression.
Curcumin is a natural compound derived from turmeric plant (Curcuma longa L.), has received attention for its biological activities, such as anticancer, anti-inflammatory, and antioxidant activities [6,7]. Curcumin modulates various immune regulators, which play a key role in its anticancer properties. Curcumin is also capable of influencing both the expression and activity of immune cytokines [8]. Curcumin shows potential as an anticancer agent by inhibiting protein aggregation and misfolding, preventing cancer cell growth, also triggers apoptosis and inhibits angiogenesis [9]. Research demonstrated that curcumin reduced cell proliferation and eradicated by 50 % and reduced spheroid size in CSC subpopulations. Additionally, curcumin reported to exhibit cancer-preventive effects by inhibiting tumor development and functioning as a chemopreventive agent. [10]. Nonetheless, the use of curcumin to downregulate SOX-2 and OCT-4 expression in stemness of tumor cell has not been reported before.
This study investigates the antitumor potential of curcumin through molecular docking simulations and the gene expression analysis. Molecular docking explore the binding interactions between curcumin and its protein targets (SOX-2, OCT-4, and IGFBP2), providing insights into the molecular mechanisms underlying its activity. Concurrently, qRT-PCR assays measure changes in SOX-2 and OCT-4 gene expression in glioblastoma cells treated with curcumin, showing its effect on transcriptional regulation. By combining computational and experimental methodologies, this research aims to uncover therapeutic strategies that target CSC-associated pathways and improve outcomes for patients with glioblastoma.
Materials and methods
Preparation of curcumin
Curcumin was acquired from Plamed Green Science Limited, China. The formulation was conducted following the method [11]. After that, curcumin was initially diluted in 100 % dimethyl sulfoxide (DMSO), and then further diluted resulting in a final concentration containing 1 % DMSO.
Molecular docking
Molecular docking was utilized to present the curcumin potential as antitumor. Proteins target that used were related to inflammatory pathway and, including SOX-2, OCT-4, and IGFBP2. Proteins target were derived from RCSB (rcsb.org/) with PDB ID 8BX2 and 2H7T, respectively then prepared in Autodock 4.2 [12] by discarding water and native ligand. Molecular docking was performed in AutoDock Vina [13]. Proteins target was redocking with native ligand to validated the binding site. The results of molecular docking was binding affinity value from protein and compound interactions. Visualization of the 3D and 2D interaction were done in Discovery Studio 2021 [14].
GBM cells culture
Glioblastoma
multiforme (GBM) cell line (ATCC HTB-14)
- U87
was
obtained from Aretha Medika Utama, BBRC, Indonesia. Cells were
removed from liquid nitrogen tanks (
196
°C) and thawed at 37 °C for 2 min. The cells were grown in
Dulbecco’s modified Eagle’s culture medium
(Biowest,
L0103-500) culture medium consist of 10 % (v/v) Fetal Bovine Serum
(Biowest S1810-500), 1 % Antibiotic-antimycotic (Biowest,
L0010-100), 1 % amphotericin B (Biowest, L0009-050), 1 % MEM
vitamins 100x (Biowest, X0556-100), and 0.1 % gentamicin (Gibco,
12750060) [15].).
The incubation took place in a humidified atmosphere with 5 % CO2
at 37 °C, with a regular medium replacement every 2 days. The
confluent cells were collected for subsequent analysis by using
Trypsin 0.25 % EDTA (Biowest, L0931-500) [16,17].
The cells were then plated onto a 6-well-plate for treatment, which
was divided into 6 groups, namely: 1)
untreated GBM cells; 2)
GBM cells + DMSO 1 %; 3)
GBM
cells + Temozolomide (TMZ)
300
µM; 4)
GBM
cells + Curcumin 50 µg/mL; 5)
GBM
cells + Curcumin 100 µg/mL; 6)
GBM
cells + Curcumin 200 µg/mL.
Quantification of SOX-2 and OCT-4 genes expression
GBM cells treated with 50, 100, and 200 µg/mL curcumin. The cells were prepared for RNA isolation and cDNA synthesis for further analysis. RNA isolation was performed with Direct-zol RNA Miniprep Plus Kit (R2073, Zymo). cDNA synthesis was conducted using iScript Reverse Transcription Supermix (170 - 8841, Bio-Rad), as described in the manufacturer’s instructions. cDNA was combined with nuclease free water (R0581, Thermocientific), primers (Macrogen), and SsoFast Evagreen Supermix (172 - 5200, Bio-Rad). The SOX-2 and OCT-4 genes expression were assessed with qRT-PCR (PikoReal 96, Thermo Scientific) and SsoFast Evagreen Supermix (G8830A, Agilent). The qPCR protocol included pre-denaturation at 95 °C for 5 min; denaturation with 40 cycles at 95 °C for 30 s, annealing with 40 cycles at 63 °C for 40 s, and elongation at 72 °C for 60 s. Primer sequences that used are detailed in Table 1 [15,18].
Table 1 Primer sequences.
Gen |
Forward (5′-3′) |
Reverse (5′-3′) |
Product Length (bp) |
Reference |
GADPH |
GCCAAAAGGGTCATCATCTC |
TGAGTCCTTCCACGATACCA |
178 |
NM_001357943.2 |
SOX-2 |
CAACCAGAAAAACAGCCCGG |
TGTGCATCTTGGGGTTCTCC |
170 |
NM_003106.4 |
OCT-4 |
GAAGCCTTTCCCCCTGTCTC |
CCCTGTCCCCCATTCCTAGA |
89 |
NM_001285986.2 |
Statistical analysis
The data was analysed with IBM SPSS Statistics (version 20.0; SPSS Inc; USA). The data was performed normality test (Shapiro-Wilk) and homogeneity test (Levene), then data analysis was performed through one-way analysis of variance (ANOVA) (p ≤ 0.05), then followed by Tukey HSD post test for normally distributed and homogenous data. The p value was ≤ 0.05 [19].
Results and discussion
Molecular docking
Curcumin was analyzed in molecular docking against SOX-2, OCT-4, and IGFBP2 proteins. Curcumin was successfully docked with all target proteins. Molecular docking results visualized in 3D showed the test compounds successfully bind with the protein active site (Figure 1). 2D visualization demonstrated protein-ligand interaction, green circles indicated hydrogen bond and pink or purple circles indicated hydrophobic interaction (Figure 2). SOX-2 & OCT-4 possessed lower binding affinity values and more protein-ligand interaction compared to IGFBP2 (Table 2). The lower binding affinity value indicated stronger protein-ligand interaction.
|
|
(A) |
(B) |
Figure 1 3D Visualization of molecular docking results. Yellow compound represented Curcumin against (A) SOX-2 & OCT-4, (B) IGFBP2.
|
|
(A) |
(B) |
Figure 2 2D Visualization of molecular docking results. Yellow compound represented Curcumin against (A) SOX-2 & OCT-4, (B) IGFBP2.
Table 2 Binding affinity value and amino acid residue from molecular interaction.
Compound |
Protein target |
Binding affinity |
Hydrogen bond |
Hydrophobic Interaction |
Curcumin |
SOX-2 & OCT-4 |
-5,7 kcal/mol |
ARG4, ARG59, LYS70, TYR71 |
HIS62, ARGH59, MET63, LYS70 |
IGFBP2 |
-5,3 kcal/mol |
- |
ARG62, LYS55 |
Molecular docking studies have become an essential tool in drug discovery, particularly for understanding the interactions between small molecules and their protein targets. These proteins are critical in maintaining cancer stem cell properties and promoting tumor progression, making them relevant targets for therapeutic intervention [20]. The results of the molecular docking simulations indicate that curcumin exhibits lower binding affinities towards SOX-2 and OCT-4 compared to IGFBP2. However, the interactions observed with SOX-2 and OCT-4 are characterized by a higher number of hydrogen bonds and hydrophobic interactions, which could enhance the stability of the curcumin-protein complexes [21]. Hydrogen bonds are crucial for the specificity of ligand-receptor interactions, while hydrophobic interactions contribute to the overall binding affinity and the complex stability [22]. The presence of multiple hydrogen bonds suggests that curcumin may effectively modulate the activity of these transcription factors, potentially disrupting their roles in maintaining cancer stemness and promoting tumor growth [23].
The implications of these findings are significant, as they highlight the multifaceted interactions of curcumin with critical proteins involved in cancer biology. By targeting SOX-2 and OCT-4, curcumin may suppress the self-renewal cancer stem cells capabilities, thereby reducing tumor recurrence and enhancing the efficacy of existing therapies [24]. Furthermore, the interactions with IGFBP2 may provide an additional mechanism through which curcumin can exert its antitumor effects, potentially leading to a more comprehensive therapeutic strategy against various malignancies [25].
SOX-2 and OCT-4 genes expression
Curcumin treatment in GBM cells was downregulated SOX-2 and OCT-4 genes expression significantly (Figure 3). Each concentration decreased the SOX-2 gene expression significantly lower compared with negative control. Curcumin 100 and 200 µg/mL decreased the OCT-4 gene expression significantly lower compared with negative control. Comparison control was able to upregulated SOX-2 and OCT-4 gene expression significantly compared with negative control, vehicle control, and curcumin treatment.
(A) |
(B) |
Figure 3 Effect of curcumin towards SOX-2 and OCT-4 gene expressions in GBM cells. (A) SOX-2; (B) OCT-4. Data is represented as mean ± SD. Treatment negative control (NC): untreated GBM cells; vehicle control, (DMSO): GBM cells + DMSO 1 %; positive control, (TMZ): GBM cells + TMZ 300 µM, (50): GBM cells + Curcumin 50 µg/mL, (100): GBM cells + Curcumin 100 µg/mL, (200): GBM cells + Curcumin 200 µg/mL. Significant statistical differences were determined using Tukey’s HSD post hoc test (p ≤ 0.05), then presented by different letters (a, b, c, cd, d, e) in SOX-2 and (a, b, c, d) in OCT-4 gene expressions.
TMZ is commonly used alongside radiotherapy as a first-line treatment for cancer or high-grade gliomas [26]. TMZ is effective in eliminating a subset of GBM cells, the remaining cells have the capacity to adapt and develop resistance mechanisms. The TMZ and cyclopamine combination has been shown to upregulate the SOX-2 and OCT-4 expression in GBM cells. These findings suggest that, although TMZ initially targets tumor cells, its treatment may inadvertently enhance stemness properties, potentially contributing to therapeutic resistance and tumor recurrence [27].
Curcumin treatment significantly downregulated the SOX-2 and OCT-4 genes expression in GBM cells to provide compelling evidence for the curcumin potency as a therapeutic agent in targeting cancer stem cell properties. The downregulation of these genes, which are critical markers of stemness and pluripotency, suggests that curcumin may inhibit the maintenance of the cancer stem cell phenotype, thereby reducing tumor aggressiveness and potential recurrence. The use of curcumin to downregulate expression of SOX-2 and OCT-4 in stemness of tumor cell is not previously reported
SOX-2 and OCT-4 expressions are often linked to the maintenance of undifferentiated states and the aggressive behavior of tumors [28]. The align with previous studies that curcumin has been shown to exhibit anti-cancer effects by modulating multiple signaling pathways, which may include the downregulation of stemness-related genes [29]. The upregulation of SOX-2 and OCT-4 promotes not only tumor initiation and development, but also enhances the cell's ability to evade therapeutic interventions [28]. This resistance is particularly concerning in glioblastoma, where the expression of these markers has been linked to the aggressive nature of the disease and its propensity for recurrence [27]. Despite this study showed satisfactory results, there were several obstacles encountered during the research process, especially at the cell culture stage. The main obstacles include the difficulty in maintaining optimal cell culture conditions and the time required to wait for the cells to reach the desired confluence level.
Conclusions
Curcumin demonstrates potential as an antitumor agent based on both in silico and in vitro analyses. Molecular docking results revealed that curcumin successfully binds to SOX-2, OCT-4, and IGFBP2. In vitro experiments using qRT-PCR confirmed that curcumin treatment effectively downregulated the SOX-2 and OCT-4 mRNA expression levels in glioblastoma cells, particularly at higher concentrations. This study emphasizes the potential of curcumin for therapeutic agents in glioblastoma and other cancers.
Acknowledgements
The authors gratefully acknowledge the financial support provided by Universitas Terbuka through a research grant under Contract Number B/1160/UN31.LPPM/PM.01.01/2024. The authors express sincere gratitude to Aretha Medika Utama, Indonesia, for their invaluable support of facilities and materials.
References
N Grech, T Dalli, S Mizzi, L Meilak, N Calleja and A Zrinzo. Rising incidence of glioblastoma multiforme in a welldefined population. Cureus 2020; 12(5), e8195.
Z Peng, L Liu, W Zhang and X Wei. Pluripotency of dental pulp cells and periodontal ligament cells was enhanced through cell‐cell communication via STAT3/Oct‐4/Sox2 signaling. Stem Cells International 2021; 2021(1), 8898506.
X Wu, N Wang, J Liang, B Wang, Y Jin, B Liu and Y Yang. Is the triggering of PD-L1 dimerization a potential mechanism for food-derived small molecules in cancer immunotherapy? A study by molecular dynamics. International Journal of Molecular Sciences 2023; 24(2), 1413.
S Chen, W Gao, MJ Zhang, JYW Chan and TS Wong. Curcumin enhances cisplatin sensitivity by suppressing NADPH oxidase 5 expression in human epithelial cancer. Oncology Letters 2019; 18(2), 2132-2139.
T Li, ME Forbes, GN Fuller, J Li, X Yang and W Zhang. IGFBP2: Integrative hub of developmental and oncogenic signaling network. Oncogene 2020; 39(11), 2243-2257.
D Diki and M Dwisatyadini. Curcumin affecting caspase 1 and caspase 9 increase and cell death in cervical cancer cell culture. In: Proceedings of the 3rd Konsorsium Biologi Indonesia Congress, Bengkulu, Indonesia, 2020.
S Katta, A Srivastava, RL Thangapazham, IL Rosner, J Cullen, H Li and S Sharad. Curcumin-gene expression response in hormone-dependent and independent metastatic prostate cancer cells. International Journal of Molecular Sciences 2019; 20(19), 4891.
V Zoi, V Galani, GD Lianos, S Voulgaris, AP Kyritsis and GA Alexiou. The role of curcumin in cancer treatment. Biomedicines 2021; 9(9), 1086.
W Shi, W Lin, W Ge, L Chen, T Zhang, W Guo and D Yin. Curcumin inhibits liquid–liquid phase separation of fused in sarcoma and attenuates the sequestration of pyruvate kinase to restore cellular metabolism. Food & Function 2023; 14(10), 4621-4631.
NA Satar, MN Ismail and BH Yahaya. Synergistic roles of curcumin in sensitising the cisplatin effect on a cancer stem cell-like population derived from non-small cell lung cancer cell lines. Molecules 2021; 26(4), 1056.
D Rahmat, Y Farida, AT Brylianto, R Sumarny and S Kumala. Antidiabetic activity of nanoparticles containing javanese turmeric rhizome extract: The strategy to change particle size. International Journal of Applied Pharmaceutics 2020; 12(4), 90-93.
GM Morris, H Ruth, W Lindstrom, MF Sanner, RK Belew, DS Goodsell and AJ Olson. Automated docking with selective receptor flexibility. International Journal of Computational Chemistry 2009; 30(16), 2785-2791.
O Trott and AJ Olson. AutoDock vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. Journal of Computational Chemistry 2010; 31(2), 455-461.
W Widowati, CN Ginting, INE Lister, E Girsang, A Amalia, SHB Wibowo and HSW Kusuma. Anti-aging effects of mangosteen peel extract and its phytochemical compounds: Antioxidant activity, enzyme inhibition and molecular docking simulation. Tropical Life Sciences Research 2020; 31(3), 127-144.
W Widowati, TL Wargasetia, F Rahardja, RF Gunanegara, D Priyandoko, ME Gondokesumo, A Novianto, A Yati and R Rizal. hWJMSCs inhibit inflammation and apoptosis in an ARDS cell model. Journal of Taibah University Medical Sciences 2023; 18(6), 1519-1526.
A Faried, W Widowati, R Rizal, HMB Bolly, D Halim, WS Widodo, HB Satrio, N Wibowo, R Noverina, FP Thajono and MZ Arifin. Assessment of intratumoral heterogeneity in isolated human primary high-grade glioma: Cluster of differentiation 133 and cluster of differentiation 15 double staining of glioblastoma subpopulations. Journal of Medical Sciences 2021; 9(A), 87-94.
W Widowati, DK Jasaputra, SB Sumitro, MA Widodo, T Mozef, R Rizal, HSW Kusuma, DR Lasksmitawati, H Murti, I Bachtiar and A Faried. Effect of interleukins (Il-2, il-15, il-18) on receptors activation and cytotoxic activity of natural killer cells in breast cancer cell. African Health Sciences 2020; 20(2), 822-832.
INE Lister, CN Ginting, E Girsang, ED Nataya, AM Azizah and W Widowati. Hepatoprotective properties of red betel (Piper crocatum Ruiz and Pav) leaves extract towards H2O2-induced HepG2 cells via anti-inflammatory, antinecrotic, antioxidant potency. Saudi Pharmaceutical Journal 2020; 28(10), 1182-1189.
W Widowati, L Darsono, MR Natariza, NW Waluyo, AMG Tenda, BH Siahaan, R Oktaviani, FH Zahiroh, HS Utomo and R Rizal. Antidiabetic, antidyslipidemia, and renoprotector potency of butterfly pea flower extract (Clitorea ternatea L.) in diabetes mellitus and dyslipidemia rats model. Open Veterinary Journal 2024; 14(5), 1135-1145.
MJ Ahsan, K Choudhary, A Ali, A Ali, F Azam, AH Almalki, EY Santali, MA Bakht, A Tahir and Salahuddin. Synthesis, DFT analyses, antiproliferative activity, and molecular docking studies of curcumin analogues. Plants 2022; 11(21), 2835.
F Zheng, J Lu, C Wang, H Yu, Y Fu and D Ma. Curcumin enhances ATG3-dependent autophagy and inhibits metastasis in cervical carcinoma. Cell Division 2024; 19(1), 33.
F Yang, S Li, X Hu, X Li and H Li. Identifying the antitumor effects of curcumin on lung adenocarcinoma using comprehensive bioinformatics analysis. Drug Design, Development and Therapy 2022; 16, 2365-2382.
S Dotolo, C Cervellera, M Russo, GL Russo and A Facchiano. Virtual screening of natural compounds as potential PI3K-AKT1 signaling pathway inhibitors and experimental validation. Molecules 2021; 26(2), 492.
S Singh and S Bhatia. In silico identification of albendazole as a quorum sensing inhibitor and its in vitro verification using CviR and LasB receptors based assay systems. BioImpacts 2018; 8(3), 201-209.
R Yousefi. Binding of curcumin near the GBT440 binding site at the alpha cleft in the sickle cell hemoglobin model [Pdb ID: 1NEJ]. Journal of Advanced Biomedical and Pharmaceutical Sciences 2024; 7(2), 70-74.
R Ortiz, G Perazzoli, L Cabeza, C Jimenez-Luna, R Luque, J Prados and C Melguizo. Temozolomide: An updated overview of resistance mechanisms, nanotechnology advances and clinical applications. Current Neuropharmacology 2021; 19(4), 513-537.
GB Carballo, D Matias, JH Ribeiro, LS Pessoa, AM Arrais-Neto and TCLDSE Spohr. Cyclopamine sensitizes glioblastoma cells to temozolomide treatment through Sonic hedgehog pathway. Life Sciences 2020; 257, 118027.
DC Venugopal, CL Caleb, NP Kirupakaran, V Shyamsundar, S Ravindran, M Yasasve, A Krishnamurthy, T Harikrishnan, S Sankarapandian and V Ramshankar. Clinicopathological significance of cancer stem cell markers (OCT-3/4 and SOX-2) in oral submucous fibrosis and oral squamous cell carcinoma. Biomedicines 2023; 11(4), 1040.
MT Mirgani, B Isacchi, M Sadeghizadeh, F Marra, AR Bilia, SJ Mowla, F Najafi and E Babaei. Dendrosomal curcumin nanoformulation downregulates pluripotency genes via miR-145 activation in U87MG glioblastoma cells. International Journal of Nanomedicine 2014; 9, 403-417.