Trends
Sci.
2025; 22(7):
9983
Hormetic Effect of Mixed Subtypes 1&3 of Blastocystis sp. Antigen Exposure on N-Cadherin Expression in the HT-29 Colorectal Cancer Cell Line and Its Relationship with Cell Migration
Selfi Renita Rusjdi1, Nuzulia Irawati1,*, Yanwirasti2, Noza Hilbertina3 and Tofrizal3
1Department of Parasitology, Faculty of Medicine, Universitas Andalas, Padang 25163, Indonesia
2Department of Anatomy, Faculty of Medicine, Universitas Andalas, Padang 25163, Indonesia
3Department of Anatomical Pathology, Faculty of Medicine, Universitas Andalas, Padang 25163, Indonesia
(*Corresponding author’s e-mail: [email protected])
Received: 21 February 2025, Revised: 24 March 2025, Accepted: 13 April 2025, Published: 30 May 2025
Abstract
Colorectal cancer is one of the most common malignancies and the second leading cause of cancer-related deaths worldwide. The disease is associated with intestinal protozoan infections, including Blastocystis sp. Mixed subtypes 1&3 of Blastocystis sp. are frequently found in the fecal specimens of colorectal cancer patients in West Sumatera, Indonesia. The mechanism by which these protozoa influence the pathogenesis and course colorectal cancer is still unclear even it is debatable whether Blastocystis sp. are protecting or promoting cancer. This study aimed to determine the effects of mixed subtypes 1 and 3 of Blastocystis sp. antigen on N-cadherin expression and the migration of the HT-29 colorectal cancer cell line. It was in vitro experimental study and used a post-test only control group design. The experiment was conducted via a post-test only control group design. HT-29 cells were divided into 1 control group and 5 treatment groups and subjected to various concentrations of Blastocystis sp. antigen (0.005, 0.01, 0.05, 0.1 and 0.5 μg/mL). N-cadherin gene expression was measured via qRT-PCR, while cell migration was determined via a scratch assay and analyzed via Image J software. The effects of the antigens on N-cadherin expression and cell migration were analyzed via 1 Way Anova, followed by Tukey’s test. The results revealed that the highest and lowest expression levels of N-cadherin were detected in the 0.5 and 0.01 μg/mL groups, respectively. The highest and lowest migration rates were found at 0.5 and 0.05 μg/mL, respectively. There was a significant difference in the expression of N-cadherin and the migration of HT-29 cells after the administration of mixed subtypes 1 and 3 Blastocystis sp. various concentrations. Furthermore, there was a correlation between N-cadherin and the migration of HT-29 cells. These results showed that Blastocystis sp. had promoted cancer at certain concentrations and indicated a hormetic effect after reaching optimal concentrations, influencing cell migration via N-cadherin.
Keywords: Blastocystis sp., Colorectal cancer, HT-29, N-cadherin, Cell migration, Sumatera, Indonesia
Colorectal cancer is the third most common malignancy in the world after breast and lung cancer. According to the Global Cancer Observatory (GLOBOCAN), the number of new cases of colorectal cancer has reached 1.9 million. This disease constitutes 10 % of all malignancies and is the second leading cause of cancer-related deaths worldwide. In Indonesia, the prevalence of this disease in the last 5 years has continued to increase, reaching 104,235 or 37.3 % of all malignancies [1,2].
In general, colorectal cancer is often associated with Blastocystis sp. This protozoa lives in the intestines of humans and certain animals and is referred to as a potential zoonotic disease. There are several subtypes that infect humans, including 1,2,3,4,6 and 7 with mixed subtypes 1 and 3 being the most frequently found in West Sumatera, Indonesia [3]. Eradication of these protozoa often fails because of drug resistance and the inability of the host’s immune system to counter infection. Several epidemiological, in vitro and in vivo studies show that Blastocystis sp. plays a role in the oncogenesis process and influences the progression of colorectal cancer in a single subtype. Epidemiologic studies in Turkey, Saudi Arabia, Poland and Uzbekistan have reported high incidence of Blastocystis sp. infection in colorectal cancer patients. These studies concluded that Blastocystis sp. has an important role in the pathogenesis and progression of CRC. The dominant Blastocystis subtypes vary in each country. The dominant subtypes in Turkey, Poland and Saudi Arabia are subtype 4, subtype 1 and subtype 3 respectively. In the general population worldwide, it also shows that the dominance of Blastocystis sp. subtypes vary greatly and have different pathogenicity [4-6]. A study in a mouse model of colorectal cancer obtained by induction of azoxymethane (AOM) revealed that subtype 3 of Blastocystis sp. infection exacerbated carcinogenesis. Histopathological examination proved that Blastocytis sp. infection caused colonic aberrant crypt foci (ACF) and adenomas formation in infected rats and elevation of urinary advanced oxidative protein products (AOPP) and hydrogen peroxide [7]. In vitro studies on colorectal cancer cell lines HCT-116 revealed that separately of subtypes 1, 2, 3, 6 and 7 of Blastocystis sp. antigen highly increased transforming growth factor beta (TGF-β) and suppressed interferon γ and p53 gene expression in HCT116 cells, thus suggesting that it may have a supportive influence on the proliferation, invasiveness and metastatic properties of colorectal cancer cells [8]. In vitro studies with CCD-18Co and HCT116 showed that incubation of these tumor cells with Blastocystis sp. exposure could increase cell multiplication and reduce the effectiveness of 5-fluorouracil chemotherapy treatment [9]. Nowadays, the pathomechanism in cancer progression is still unclear. There is no research that investigates the effect of Mixed subtypes 1 and 3 of Blastocystis sp. on the Epithelial mesenchymal transition (EMT) process [3,6,10].
Epithelial mesenchymal transition (EMT) is a process characterized by epithelial cells losing their polarity and adhesion properties, allowing them to transform into mesenchymal cells that can easily migrate and invade. Generally, EMT occurs in several pathophysiological conditions in the human body, such as inflammation, wound healing, and cancer development. Under these conditions, E-cadherin expression is inhibited followed by an increase in N-cadherin, which causes epithelial cells to experience damage to intercellular adhesion. This process is known as cadherin switching. Cadherin is a transmembrane protein that acts as an adhesion molecule, and forms adherens junctions through a calcium-dependent mechanism [11,12].
N-cadherin is a key indicator to assess the ongoing EMT process. It is related to development, invasion and metastases cancer [13,14]. N-cadherin is widely used by clinicians as a biomarker to determine metastatic status and patient’s prognosis [15]. At the cellular level, N-cadherin can increase the proliferation, viability and migration of cancer cells. High N-cadherin expression is associated with poor prognosis, increased invasion, and increased metastasis ability [12,14,16].
Materials and methods
This research was in vitro experimental study and used a posttest only control group design. It was approved by the Research Ethics Committee of Faculty of Medicine Universitas Andalas, Padang, West Sumatera, Indonesia (N0.513/UN16.2/KEP-FK/2023).
Isolation of Blastocystis sp.
Blastocystis sp. was isolated from stool samples of colorectal cancer patients at Dr. M. Djamil Hospital Padang, West Sumatra Province, Indonesia. The samples were screened via stool smears within a maximum of 6 h after collection to identify Blastocystis sp. without other gastrointestinal parasites. Approximately 50 mg of positive Blastocystis sp. stool samples were inoculated into 3 mL of Jones medium supplemented with 10 % horse serum. Parasite cultures were incubated at 37 C in a CO2 incubator and screened daily for 5 - 7 days. The samples were considered positive when vacuolar, granular, and ameboid forms of Blastocystis sp. were found and confirmed by PCR examination via universal primers and continued with subtype identification as shown in the table below.
Table 1 Primers for q-PCR.
Subtype |
Primer |
Product size (bp) |
Sequence 5’- 3’ |
GenBank accession number |
Reference |
- |
BL18SPPF1 F |
342 |
AGTAGTCATACGCTCGTCTCAAA |
MT645814.1 |
[17] |
|
BL18SR2PP R |
|
TCTTCGTTACCCGTTACTGC |
|
|
1 |
SB83 F |
351 |
GAAGGACTCTCTGACGATGA |
AF166086 |
[18] |
|
SB83 R |
|
GTCCAAATGAAAGGCAGC |
|
|
2 |
SB155 F |
650 |
ATCAGCCTACAATCTCCTC |
AF166087 |
[18] |
|
SB155 R |
|
ATCGCCACTTCTCCAAT |
|
|
3 |
SB227 F |
526 |
TAGGATTTGGTGTTTGGAGA |
AF166088 |
[18] |
|
SB227 R |
|
TTAGAAGTGAAGGAGATGGAAG |
|
|
4 |
SB332 F |
338 |
GCATCCAGACTACTATCAACATT |
AF166091 |
[3] |
|
SB332 R |
|
CCATTTTCAGACAACCACTTA |
|
|
5 |
SB340 F |
704 |
TGTTCTTGTGTCTTCTCAGCTC |
AY048752 |
[3] |
|
SB340 R |
|
TTCTTTCACACTCCCGTCAT |
|
|
6 |
SB336 F |
317 |
GTGGGTAGAGGAAGGAAAACA |
AY048751 |
[3] |
|
SB336 R |
|
AGAACAAGTCGATGAAGTGAGAT |
|
|
7 |
SB337 F |
487 |
GTCTTTCCCTGTCTATTCTGCA |
AY048750 |
[3] |
|
SB337 R |
|
AATTCGGTCTGCTTCTTCTG |
|
|
Blastocystis cultures are maintained in vitro and subcultured every 3 to 4 days. The basic aseptic methods were used during the maintenance of these parasite cultures. The medium solution for culture (Jones’ medium) was put into an autoclave at 121 C for 24 h. Before inoculating fecal samples, the culture medium was put back into the autoclave and incubated at 37 C in the incubator. On the third and fourth days, culture samples were taken using sterile pipettes for microscopic examination.
Preparation of Jones’ medium
The Jones’ medium for culturing Blastocystis sp. consists of disodium phosphate (Na2HPO4), distilled water, monopotassium phosphate (KH2PO4), and yeast extract. The solution was sterilized via an autoclave at 121 °C - for 24 h. Horse serum was added under UVR-laminar flow until the total volume reached 100 mL. A total of 5 mL of medium was added to a 7 mL culture tube and stored at −20 °C until it was ready to be used. When inoculation is carried out, the medium is sterilized again [19].
Purification and isolation of antigen
Blastocystis sp. (1×105 parasites/mL) were purified from bacterially contaminated cultures via density gradient centrifugation. The cells were collected into 1 culture tube and washed twice with phosphate-buffered saline (PBS) for 5 min at 1,000 rpm. Phosphate-buffered saline commonly used in cell culture because of its stability and non-toxicity. A total of 5 mL of cell suspension was carefully layered onto 6 mL of Ficoll-Paque without shaking̵ and rotated for 20 min at 1,800 rpm. The contaminated part was found immediately above a thick layer of yellowish-white lumps. These sections were gently isolated and washed with PBS. Antigens were extracted via the freeze-thaw method via liquid nitrogen and a 37 °C water bath. The lysate was left overnight at 4 °C, followed by filtration through a 0.22 μm pore size polyethersulfone (PES) filter to eliminate bacteria. The protein concentration was determined via NanoDrop system. Nanodrop was performed because the procedure is fast and simple, without additional reagents and it can be used for small sample volume. Measurement bias was resolved by using buffers that do not affect the measurement. The lysate was stored at 20 °C until further use [18,19].
Confirmation antigen Blastocystis sp. via ELISA method
Confirmation of isolation of Blastocystis sp. antigen was performed via commercial Abnova Blastocystis sp. copro ELISA kit (Catalog No. KA0292). The procedures used 100 μL of negative control, 100 μL of positive control and 100 μL of specimen. The plate was covered and then incubated for 1 h at 37 C and 100 humidity. Washing was performed 5 times using 300 μL of wash buffer and then 100 μL of HRP horseradish peroxidase (HRP)-conjugate was added. The plate was covered and then incubated again for 1 h at 37 C and 100 % humidity. Rewashing was performed 5 times using 300 μL of wash buffer and then 100 μL of tetramethylbenzidine (TMB)-substrate conjugate was added. The plate was covered and then incubated for 15 min at room temperature. A total of 100 μL of stop solution was added. Results were observed in absorbance at a wavelength of 450/620 nm.
Preparation of HT-29 cell
HT-29 (Catalog No. CL-0118 Elabscience) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM). All media were prepared with 100 IU mL−1 penicillin, 100 µg mL−1 streptomycin, and 10 % heat-inactivated fetal bovine serum. The cell cultures were placed in an incubator at 37 C in a humid environment (95 % air and 5 % CO2) [22]. The cells were cultured in 30 wells (well plates) via exposure to different concentrations of Blastocystis sp. (0.005, 0.01, 0.05, 0.1 and 0.5 μg/mL), with 5 replications for each treatment concentration. Blastocystis sp. was exposed to colorectal cancer cells. The harvested colorectal cancer cell line (HT-29) (1×103 cells per well) in 100 μL of growth medium was placed into 96-well plates. After incubation, the samples were incubated 1 day and 1 night at 37 C in an incubator containing 5 % CO2. Blastocystis sp. at various concentrations (0.005, 0.01, 0.05, 0.1 and 0.5 μg/mL) were added to each well and incubated for 72 h. Each concentration was applied in 5 HT-29 cultures [20].
N-cadherin expression
There were 3 stages of examination, namely RNA isolation, cDNA synthesis, gradient PCR amplification, and quantitative real-time PCR (RT-PCR). Total RNA from the cultured cells was isolated via the use of 500 μL GENEzol Reagent (catalog #GZR200). The homogenizer used was 1 mL of GENEzol reagent per 50 - 100 mg of cells in the sample. Approximately 200 μL of chloroform was added, the tube was inverted, and the mixture was incubated for 5 min at room temperature. Subsequently, centrifugation was carried out at a speed of 12,000×g at a temperature of 4 °C for 15 min. The aqueous phase layer (top/clear) was transferred to a new sterile microtube, isopropanol (1:1) was added and the mixture was incubated again for 30 min at cold temperature. Centrifugation was performed at a speed of 12,000×g at 4 °C - for 10 min. The supernatant was discarded, and the pellet was washed with 350 μL of 70 % ethanol. The tube was turned upside down and vortexed slowly. Repeated centrifugation was carried out at a speed of 12,000×g at 4 °C - for 5 min, and the supernatant was discarded and vacuumed for 10 min. After vacuum, the pellet was resuspended in 25 - 40 μL RNAse-free water (depending on the number of pellets). The RNA concentration was measured via NanoDrop system.
cDNA synthesis was carried out via a synthesis kit (SensiFAST cDNA Synthesis Kit, Bioline BIO-65054). The sample was inserted into the PCR machine at 25 °C - for 10 min (primary annealing), 42 °C - for 15 min (reverse transcription), 85 °C - for 5 min (inactivation), and 4°C - for 5 min (cooling). cDNA can be used for real-time PCR or stored at −20 °C. cDNA synthesis used the SensiFAST cDNA Synthesis Kit from Bioline (BIO-65053). The primers used to detect N-cadherin gene expression (NCBI NM_001792.5) were 5’-ACAGTGGCCACCTACAAAGG-3’ for forward and 5’-CCGAGATGGGGTTGATAATG-3’ for reverse. GAPDH was used as a housekeeping gene with the primer sequence 5’-CATCATCCCTGCCTCTACTG-3’ forward and 5’-CCAAATTGCTTGTCATACCAG-3’ reverse. The primers were designed using Geneious 11.1 bioinformatics software. Gene expression examination used SensiFAST SYBR No-ROX reagent (BIO-98020) and BIO-RAD CFX96 real-time PCR machine.
RT-PCR
The material components in the PCR tube consisted of nuclease-free water, N-cadherin forward primer, N-cadherin reverse primer, SYBR GREEN, and cDNA. These components were inserted into the real-time PCR machine with an amplification range of 40 amplification cycles consisting of a 95 °C pre- denaturation step for 3 min. The core cycle consisted of 95 °C for 15 s, 53 °C for 30 s for E-cadherin, 55 °C for 15 s for N-cadherin, and 59.4 °C for 30 s for GAPDH. After completing PCR, the Ct or Cq value was obtained and processed via the Livak method.
Measurement of N-cadherin expression
Gene concentration measurements in this study were performed via the relative quantification method [23].
ΔCT experiment = CT experiment target – CT experiment housekeeping
ΔCT control = CT control target – CT control housekeeping
ΔΔCT experiment = ΔCT experiment – ΔCT control
Comparison of gene expression levels = 2 ΔΔCT
HT-29 migration in scratch assay
Cell migration measurements were carried out via the scratch wound healing assay method. This method was carried out by making scratches manually on a cell monolayer via 100 µL sterile pipette tip perpendicularly via a plate lid that had been wiped with alcohol tissue on all plates growing on cells exposed to Blastocystis sp. supplemented with fetal bovine serum. The direction of the scratch and pressure applied must be the same for each well. The cells were washed with Phosphate Buffer Saline (PBS) until the scratched part had no attached cells and no floating cells. To minimize the limitations of manual scratching, a consistent technique in making wounds and 5 replications were applied. To minimize subjectivity, researchers used the same microscope (Zess Axiovert 40C), the same magnification, the same camera and the same settings for 5 fields of view.
Cell migration measurements were carried out by measuring the gap distance line (manual drawing) between opposite cells from an image of the object under a microscope within 72 h. The migration distance obtained was processed with the help of ImageJ software. Cell migration assessed by the average of 10 gap distance lines between opposite cells [24,25].
Statistical analysis
The SPSS version 29.0.2.0 application was used in data analysis. The normality of data distribution was tested via the Kolmogorov-Smirnov Test (p = 0.750 for N-cadherin and p = 0.734 for migration). Homogeneity was tested via the Levene’s (p = 0.266 for N-cadherin and p = 0.853 for migration). The data were analyzed statistically via 1-way ANOVA to determine differences in N-cadherin expression and the migration of HT-29 cells after administration of several concentrations of antigen and Tukey’s post hoc tests were performed. p-values of less than 0.05 (p < 0.05) were considered to indicate a significant difference. The correlation between N-cadherin and migration was subsequently analyzed by Pearson’s bivariate correlation test.
Results and discussion
The results revealed that the highest mean N-cadherin expression was detected in the 0.5 μg/mL treatment group, and the lowest was detected in the 0.01 μg/mL group. This study indicates significant differences expressions of N-cadherin in various concentration of Blastocystis sp. in cell culture. These significant differences were detected in the 0.005 - 0.5, 0.01 - 0.5, 0.05 - 0.5 and 0.1 - 0.5 μg/mL (Table 2). The results showed that at certain concentrations, exposure to the Blastocystis sp. antigen inhibited N-cadherin expression. This inhibition continued until the optimum dose was 0.01 μg/mL. At the next dose, there was an increase in N-cadherin expression due to the hormetic effect, which was significantly influenced by the concentration of exposure. This phenomenon is characterized by a nonlinear exposure effect with increasing dose, namely, a high exposure dose results inversely proportional to a low dose. An increase was initially observed at a concentration of 0.05 μg/mL. Hormesis seen in “u-shaped” (Figure 2(A)) means low-dose caused inhibition of N-cadherin and high-dose cause stimulation. An “inverted u-shaped” of gap distance shown in Figure 2(B) was explained that small gap distance indicates high migration of cancer cells. It is clearly explained in Figure 4 which is shown that N-cadherin expression are correlated with the HT-29 cell migration. It meant low N-cadherin expression inhibited migration of HT-29 cells and implied that low antigen concentration could give beneficial effects to suppress cancer migration, invasion and metastases. This phenomenon occurs because of the response of HT-29 cells to stress. At low to moderate concentrations, an adaptive cell response occurs, which causes a temporary decrease in N-cadherin expression and induces a beneficial effect. At this stage, the cell is able to activate a protective signaling pathway that influences the expression of transcription factors or epigenetic regulators controlling N-cadherin expression [23-25]. Exposure to high concentrations of antigen can induce a stronger stress response, causing changes in the cell phenotype including high N-cadherin which can facilitate migration and invasion [29]. An increase in N-cadherin is an EMT marker that is associated with malignant transformation, clinical worsening, and prognosis, particularly for patients with colorectal cancer. A decrease in N-cadherin can cause cells to experience a reduction in malignant properties. A decrease in N-cadherin can cause cells to experience a reduction in malignant properties [14].
Figure 1 Morphology of Blastocystis sp. (vary in size 5 - 40 µm) in direct fecal smears and subcultured in Jones’ medium. Blastocystis sp. were isolated from isolated from colorectal cancer fecal samples (a) and subcultured (b) under a microscope (1,000).
Figure 2 Effects of mixed subtypes 1&3 of Blastocystis sp. at different concentrations on N-cadherin mRNA expression (A) and the migration of HT-29 cells (B) after 72 h of treatment. The data shows the hormetic effects on N-cadherin mRNA expression and the migration of HT-29 cells in the control and treated groups. An inverse relationship between treatment concentration and N-cadherin mRNA expression was detected in the control group̵, (0.005 - 0.01 μg/mL), and a positive relationship was detected higher concentrations (0.05, 0.1 and 0.5 μg/mL). A positive relationship was detected between the treatment concentration and gap distance in the control group̵, (0.005 - 0.05 μg/mL) and an inverse relationship was detected at the next concentration (0.1 - 0.5 μg/mL). The data are expressed as the means ± standard deviations of 5 separate experiments. The data were analyzed via 1-way ANOVA. The results were considered statistically significant when p < 0.05 compared with the control.
Figure 3 A qualitative scratch test was used to determine the effect of mixed subtypes of the 1&3 Blastocystis sp. antigens on the migration ability of HT-29 cells. Pictures were taken with ZeissAxiovert 40C microscope at 100× magnification and processed with imageJ software. Migration was determined by measuring the outer distance between tumor cells at 10 pair points and reported as the average value (μm). (a) is the control (untreated group) and (b-f) are the 0.005, 0.01, 0.05, 0.1 and 0.5 μg/mL treatment groups. Antigen exposure caused biphasic changes in tumor cell migration. The highest concentration of antigen had the greatest effect on the migration of tumor cells in the medium.
Figure 4 Correlation between N-cadherin expression mRNA and the migration of HT-29 cells. Pearson’s correlation coefficient (r) and p-values are shown. The results reveal a negative correlation, where the increase in N-cadherin mRNA expression is followed by a decrease in gap distance (decreasing gap distance means increasing the migration of HT-29 cells).
Table 2 Tukey’s test for N-cadherin expression.
Group |
Control |
0.005 μg/mL |
0.01 μg/mL |
0.05 μg/mL |
0.1 μg/mL |
0.5 μg/mL |
Control |
- |
0.157 |
0.135 |
0.129 |
0.098 |
0.635 |
0.005 μg/mL |
0.157 |
- |
1.000 |
1.000 |
1.000 |
0.005* |
0.01 μg/mL |
0.135 |
1.000 |
- |
1.000 |
1.000 |
0.004* |
0.05 μg/mL |
1.129 |
1.000 |
1.000 |
- |
1.000 |
0.004* |
0.1 μg/mL |
0.098 |
1.000 |
1.000 |
1.000 |
- |
0.003* |
0.5 μg/mL |
0.635 |
0.005* |
0.004* |
0.004* |
0.003* |
- |
These results were similar with linalool exposure on B16F10 murine melanoma cell line. It revealed hormetic effects on epithelial-mesenchymal transition markers, migration, and angiogenesis. Stress response of B16F10 cells cause inhibition effect in low concentration (0.4 mM) and opposite response occurred in high concentration (0.8 mM) [30]. Another study also found that periostin has a hormetic effect on the development of pancreatic cancer cells. Low concentration of periostin reduced mesenchymal markers and cell migration and the opposite effect occurred in high concentration via AKT activation [31].
There are several studies related to hormetic response due to the stress response of cancer cells because of exposure to certain chemotherapeutic and radiotherapy agent. High dose irradiation of human breast cancer cell line MDA-MB-231 induced tumor proliferation and invasiveness via the transfer of exosomal miR-21 [32]. Low concentration of Withaferin A (WFA) could induce anti-migration and invasion abilities for oral cancer cells by triggering Reactive Oxygen Species (ROS) production and subsequently showed the opposite effect in high concentration [33]. Low-dose naltrexone inhibited cancer cell proliferation by blocking the opioid growth factor–receptor axis and enhancing the immune response against cancer cells and the other hand in high dose showed different effects [34].
Hormesis is a complex mechanism that is influenced by several interconnected biological processes. Several studies have concluded that hormesis can occur as stress response through the activation of the NF-κB (nuclear factor kappa-B), MAPK (mitogen-activated protein kinase), AMPK (adenosine 5’-monophosphate (AMP)-activated protein kinase), mTOR (mammalian target of rapamycin), and PI3K/Akt (phosphatidylinositide 3-kinases/protein kinase B) signaling pathways and increased activity of cytoprotective proteins. All of these factors work together to overcome oxidative stress and inflammation. This process allows self-defense by cells or tissues and adapts by carrying out repairs and restoration [35].
The results of the present study revealed that the greatest mean migration of HT-29 cells was associated with the lowest gap distance in the treatment group at an exposure concentration of 0.5 μg/mL. The lowest degree of migration was found in the 0.05 μg/mL group. Statistical analysis revealed that exposure to Blastocystis sp. influenced HT-29 cell migration. These significant differences were detected in the control group −0.005, 0.01, 0.05, 0.1, 0.005 - 0.05, 0.005 - 0.5, 0.01 - 0.5, 0.05 - 0.1, 0.05 - 0.5 and 0.1 - 0.5 μg/mL (Table 3). This finding revealed that the administration of the antigen at concentration of 0.05 μg/mL caused a gradual decrease in cell migration. With increasing exposure concentration, the migration of HT-29 cells increased.
Table 3 Tukey’s test for gap distance.
Group |
Control |
0.005 μg/mL |
0.01 μg/mL |
0.05 μg/mL |
0.1 μg/mL |
0.5 μg/mL |
Control |
- |
0.015* |
0.000* |
0.000* |
0.014* |
0.642 |
0.005 μg/mL |
0.015* |
- |
0.239 |
0.002* |
1.000 |
0.000* |
0.01 μg/mL |
0.000* |
0.239 |
- |
0.290 |
0.249 |
0.000* |
0.05 μg/mL |
0.000* |
0.002* |
0.290 |
- |
0.002* |
0.000* |
0.1 μg/mL |
0.014* |
1.000 |
0.249 |
0.002* |
- |
0.000* |
0.5 μg/mL |
0.642 |
0.000* |
0.000* |
0.000* |
0.000* |
- |
The inhibitory effect on migration of Blastocystis sp. antigen at low concentrations is associated with low N-cadherin. This is supported by the gap distance curve having the same pattern as the N-cadherin expression curve and the results of the bivariate Pearson correlation test. N-cadherin is a cadherin that plays an important role in the migration process of cancer cells. N-cadherin activates Rho GTPase which is a protein that regulates the actin cytoskeleton in the process of cell division, migration, and extravasation of tumor cells to invade tissue. Rho GTPases also activate nucleation-promoting factors (NPFs), which trigger the Arp2/3 complex to regulate tumor cell migration and invasion [36].
Several studies revealed similar stimulation effects of antigen Blastocystis sp. in high dose on N-cadherin and migration of cancer cells in vitro. Exposure to the Helicobacter pylori (cagA+ vacA+) strain induces the EMT process in the RGM-1 epithelial cell line. This is characterized by increases in N-cadherin, vimentin, integrin-β1, and several other EMT markers. Increased expression of EMT markers facilitates the proliferation and migration of cancer cells [37]. Previous studies conducted on human papillary thyroid carcinoma IHH4 have shown that increasing N-cadherin expression leads to high migratory ability through the same pathway as elevated proliferative activity, namely, through the activation of the MAPK/Erk and PI3K/Akt pathways [38].
Migration is not only influenced by N-cadherin. For example, exposure of Toxoplasma gondii tachyzoites to various concentrations in the breast cancer cell lines MCF-7 and MDA-MB-231 showed that the inhibitory effect on proliferation and migration occurred through changes in BRCA1, MYC, and IL-6 gene expression [39]. Similar results were also reported in studies in which tumor cells were exposed to radiation. At low radiation concentration, there was a reduction in migration and invasion through the inhibition of JAK1/STAT3 signalling. Moreover, the opposite occurred under high-dose exposure [40].
This study only explained the effect of Blastocystis sp. antigen on N-cadherin and its relationship with cancer cell migration. Further studies are needed to investigate other key EMT markers, such as E-cadherin, Vimentin, Fibronectin, ZO-1 and others to clarify their involvement in the EMT process. This study also cannot confirm the mechanism of the suppressive effect on N-cadherin and migration, so it is necessary to investigate proliferation, apoptosis, and senescence markers.
Conclusions
In conclusion, this study revealed that mixed subtypes 1 and 3 Blastocystis sp. could increase N-cadherin expression and the migration of HT-29 cells at high concentration. The results revealed a correlation between N-cadherin expression and cell migration. These findings indicate that Blastocystis sp. can promote cancer progression by increasing migration ability of colorectal cancer cells in vitro. Moreover, further studies were recommended to investigate this phenomenon in animal studies to observe interaction between tissue, organ, intestinal microbiota to Blastocystis sp. infection and explore activated pathways. It also needs specific analysis to strengthen the hormetic effect.
Acknowledgments
The authors are grateful to Dr. Avit Suchitra Sp.B.KBD, staff of Digestive for providing fecal samples used in this study. Furthermore, the authors are grateful to Dr. Hirowati Ali, Ph. D., the head of Biomedical Laboratory of Andalas University, Indonesia for providing instruments.
References
R Marcellinaro, D Spoletini, M Grieco, P Avella, M Cappuccio, R Troiano, G Lisi, GM Garbarino and M Carlini. Colorectal cancer: Current updates and future perspectives. Journal of Clinical Medicine 2023; 13(1), 40.
F Bray, M Laversanne, H Sung, J Ferlay, RL Siegel, I Soerjomataram and A Jemal. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer Journal for Clinicians 2022; 74(3), 229-263.
E Nofita. 2024, Kajian gen Zonula Okludin (ZO-1), protein nuclear factor kappa beta (NF-kB) dan apoptosis sel epitel usus akibat infeksi campur Blastocystis subtipe 1&3 (in Indonesian). Ph. D. Dissertation. Fakultas Kedokteran Universitas Andalas, Padang, Indonesia.
RT Mohamed, MA El-Bali, AA Mohamed, MA Abdel-Fatah, MA El-Malky, NM Mowafy, DA Zaghlool, RA Bakri and SA Al-Harthi. Subtyping of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Makkah, Saudi Arabia. Parasites and Vectors 2017; 10(1), 174.
TÖ Öner, M Karabey, H Can, AD Döşkaya, M Karakavuk, A Gül, AE Köseoğlu, M Döşkaya, C Ün, AY Gürüz, S Kaya, B Pektaş and AA Gökmen. Molecular investigation of Blastocystis sp. and its subtypes in cancer patients under chemotherapy in Aegean region, Turkey. Acta Tropica 2022; 233, 106577.
M Rudzińska and K Sikorska. Epidemiology of blastocystis infection: A review of data from Poland in relation to other reports. Pathogens 2023; 12(8), 1050.
V Kumarasamy, UR Kuppusamy, P Jayalakshmi, C Samudi, ND Ragavan and S Kumar. Exacerbation of colon carcinogenesis by Blastocystis sp. PLoS One 2017; 12(8), e0183097.
M Lepczynska. The 2 faces of Blastocystis spp.: Is it the cause of colorectal cancer (CRC) or a consequence of it? Polish Annals of Medicine 2024; 31(2), 145-151.
V Kumarasamy, UR Kuppusamy, P Jayalakshmi, and SK Govind. Blastocystis sp. reduces the efficacy of 5-fluorouracil as a colorectal cancer chemotherapeutic treatment. Experimental Parasitology 2023; 251, 108564.
V Kumarasamy, WM Atroosh, D Anbazhagan, MMI Abdalla and M Azzani. Association of Blastocystis hominis with colorectal cancer: A systematic review of in vitro and in vivo evidences. World Journal Gastrointestinal Oncology 2022; 14(3), 734.
KH Rai and J Ahmed. A correlative study of n-cadherin expression with different grades of oral squamous cell carcinoma projecting as a marker of epithelial to mesenchymal transition in tumor progression. Asian Pacific Journal Cancer Prevention 2019; 20(8), 2327.
C Noronha, AS Ribeiro, R Taipa, DS Castro, J Reis, C Faria and J Paredes. Cadherin expression and EMT: A focus on gliomas. Biomedicines 2021; 9(10), 1328.
S Mustafa, S Koran and L AlOmair. Insights into the role of matrix metalloproteinases in cancer and its various therapeutic aspects: A review. Frontiers in Molecular Biosciences 2022; 9, 896099.
V Skarkova, B Vitovcova, P Matouskova, M Manethova, P Kazimirova, A Skarka, V Brynychova, P Soucek, H Vosmikova and E Rudolf. Role of n-cadherin in epithelial-to-mesenchymal transition and chemosensitivity of colon carcinoma cells. Cancers 2022; 14(20), 5146.
M Assidi. High n-cadherin protein expression in ovarian cancer predicts poor survival and triggers cell invasion. Frontiers in Oncology 2022; 12, 870820.
W Luminturahardjo, DW Soeatmadji, K Mintaroem, P Rahajoe and F Sandra. N-cadherin as an important marker in colorectal cancer: An investigation of b-catenin and cadherin expressions of SW-480 and HCT-116 cell lines. The Indonesian Biomedical Journal 2021; 13(3), 289-294.
LDN Nguyen, N Gantois, TT Hoang, BT Do, J Desramaut, D Naguib, TN Tran, AD Truong, G Even, G Certad, M Chabé and E Viscogliosi. First epidemiological survey on the prevalence and subtypes distribution of the enteric parasite Blastocystis sp. in Vietnam. Microorganisms 2023; 11(3), 731.
SF Mossallam, SAT El-Mansoury, MM Tolba, AA Kohla and SI Khedr. In vitro susceptibility of human Blastocystis subtypes to simeprevir. Saudi Journal of Biological Sciences 2021; 28(4), 2491-2501.
MA Hassan, EM Rizk and RM Wassef. Modified culture methodology for specific detection of Blastocystis hominis in stool samples. Journal of Egyptian Society of Parasitology 2016; 46(3), 541-548.
A Rajamanikam, HS Hooi, M Kudva, C Samudi and S Kumar. Resistance towards metronidazole in Blastocystis sp.: A pathogenic consequence. PLoS One 2019; 14(2), e0212542.
H Mohammad Rahimi, A Yadegar, H Asadzadeh Aghdaei, H Mirjalali and MR Zali. Modulation of microRNAs and claudin-7 in Caco-2 cell line treated with Blastocystis sp., subtype 3 soluble total antigen. BMC Microbiology 2022; 22(1), 111.
S Afrin, F Giampieri, TY Forbes-Hernández, M Gasparrini, A Amici, D Cianciosi, JL Quiles and M Battino. Manuka honey synergistically enhances the chemopreventive effect of 5-fluorouracil on human colon cancer cells by inducing oxidative stress and apoptosis, altering metabolic phenotypes and suppressing metastasis ability. Free Radical Biology and Medicine 2018; 126, 41-54.
KJ Livak and TD Schmittgen. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001; 25(4), 402-408.
R Kavarthapu and ML Dufau. Essential role of endogenous prolactin and CDK7 in estrogen-induced upregulation of the prolactin receptor in breast cancer cells. Oncotarget 2017; 8(16), 27353-27363.
A Suarez-Arnedo, FT Figueroa, C Clavijo, P Arbeláez, JC Cruz and C Muñoz-Camargo. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS One 2020; 15(7), e0232565.
SC Bondy. The hormesis concept: Strengths and shortcomings. Biomolecules 2023; 13(10), 1512.
S Tang, S Li, B Tang, X Wang, Y Xiao and RA Cheke. Hormetic and synergistic effects of cancer treatments revealed by modelling combinations of radio - or chemotherapy with immunotherapy. BMC Cancer 2023; 23(1), 1040.
X Chang, S Tamauchi, A Nakagawa, W Xinyuan, K Yoshida, A Yokoi, N Yoshikawa and H Kajiyama. Chemotherapeutic hormesis induced by the tumor microenvironment in refractory ovarian cancer. Scientific Reports 2025; 15(1), 596.
Y Guéguen, A Bontemps and TG Ebrahimian. Adaptive responses to low doses of radiation or chemicals: Their cellular and molecular mechanisms. Cellular and Molecular Life Sciences 2019; 76(7), 1255-1273.
P Pal, S Jana, I Biswas, DP Mandal and S Bhattacharjee. Biphasic effect of the dietary phytochemical linalool on angiogenesis and metastasis. Molecular and Cellular Biochemistry 2022; 477(4), 1041-1052.
Y Shimoyama, K Tamai, R Shibuya, M Nakamura, K Yamaguchi, Y Kakuta, Y Kinouchi, I Sato, A Kudo, T Shimosegawa and K Satoh. Periostin attenuates tumor growth by inducing apoptosis in colitis-related colorectal cancer. Oncotarget 2018; 9(28), 20008-20017.
K Kim, KO Jung, S Oh, YH Kim, SY Lee, S Hong, SH Cho, H Kim, S Rhee, GJ Cheon, KW Kang, JK Chung and H Youn. Radiation-induced exosomal miR-21 enhances tumor proliferation and invasiveness in breast cancer: Implications for poor prognosis in radiotherapy patients. Experimental Hematology & Oncology 2024; 13(1), 120.
TJ Yu, JY Tang, F Ou-Yang, YY Wang, SSF Yuan, K Tseng, LC Lin and HW Chang. Low concentration of withaferin a inhibits oxidative stress-mediated migration and invasion in oral cancer cells. Biomolecules 2020; 10(5), 777.
K Liubchenko, K Kordbacheh, N Khajehdehi, T Visnjevac, F Ma, JS Khan, M Storey, A Abd-Elsayed and O Visnjevac. Naltrexone’s impact on cancer progression and mortality: A systematic review of studies in humans, animal models, and cell cultures. Advances in Therapy 2021; 38(2), 904-924.
Y Wan, J Liu, Y Mai, Y Hong, Z Jia, G Tian, Y Liu, H Liang and J Liu. Current advances and future trends of hormesis in disease. npj Aging 2024; 10(1), 26.
WS Rodenburg and JD van Buul. Rho GTPase signalling networks in cancer cell transendothelial migration. Vascular Biology 2021; 3(1), R77-R95.
G Krzysiek‐Maczka, A Targosz, U Szczyrk, M Strzałka, Z Sliwowski, T Brzozowski, J Czyz and A Ptak-Belowska. Role of helicobacter pylori infection in cancer‐associated fibroblast‐induced epithelial‐mesenchymal transition in vitro. Helicobacter 2018; 23(6), e12538.
C Da, K Wu, C Yue, P Bai, R Wang, G Wang, M Zhao, Y Lv and P Hou. N-cadherin promotes thyroid tumorigenesis through modulating major signaling pathways. Oncotarget 2016; 8(5), 8131.
H Ye, X Zhou, B Zhu, T Xiong, W Huang, F He, H Li, L Chen, L Tang and Z Ren. Toxoplasma gondii suppresses proliferation and migration of breast cancer cells by regulating their transcriptome. Cancer Cell International 2024; 24(1), 144.
N Kaushik, MJ Kim, RK Kim, N Kumar Kaushik, KM Seong, SY Nam and SJ Lee. Low-dose radiation decreases tumor progression via the inhibition of the JAK1/STAT3 signaling axis in breast cancer cell lines. Scientific Reports 2017; 7(1), 43361.